La vida es sueño

Free Image Hosting at allyoucanupload.com

Columna revista Gataflora Enero 2008

A mí, después del chocolate, lo que más me gusta en el mundo es pensar pavadas. Mi abuela diría que tengo pájaros en la cabeza, pero yo prefiero pensar que soy inocente y cursi como una heroína de folletín.

Durante mucho tiempo creí que soñar despierta la mitad del día era el rasgo más llamativo de mi personalidad. Que ser una soñadora hacendosa y precisa era una cualidad especial, como ser tartamudo, pelirrojo o zurdo lo es para otras personas. Sin embargo, hace unos años, conversando con amigas, me di cuenta de que mi vicio no era mío. Que todas las mujeres pasábamos horas practicando diálogos irreales en voz alta, besándonos con actores de Hollywood entre sueños, o imaginándonos vestidas con el trench de Michelle Morgan y un collar doble de perlas viajando en el Orient Express.

Mis sueños, por ejemplo, siempre tienen que ver con amor y dinero. Me gusta pensar que soy millonaria o que por motivos extraordinarios puedo hacer un gran viaje. Miro un mapa durante horas, elijo falsos itinerarios, e incluso me debato entre dos destinos en puntos opuestos de un mismo continente. Soy una ilusa escrupulosa, cuido todos los detalles: pienso en las vacunas, en cuantos días se necesita para recorrer el país, o si alcanzará con saber inglés y pobre francés para hacerme entender.

Pero no siempre me dediqué a los viajes; cuando era soltera me volcaba más a las tonterías noveleras. Ensayaba mentalmente miles de escenas en las que alguien que me volvía loca en la vida real se enfermaba de amor por mí. Me imaginaba todos los escenarios probables, las líneas de diálogo más originales y me reía en voz alta si el chiste que alguno de mis personajes ameritaba un festejo.

A diferencia de los hombres, las mujeres no soñamos con desprolijidad. Nuestras fantasías son el cuadro hiperrealista de un artista obsesivo. No nos alcanza pensar en un par de brazos fuertes o en un millón de dólares caído del cielo. Para fantasear como se debe, las mujeres necesitamos verosimilitud marcial. Si vamos a soñar que nadamos en dinero, antes de gastar un centavo virtual necesitamos saber cómo llegó esa plata a nuestras manos, si retiramos una suma fija del banco o tenemos baldes llenos de monedas, si vamos a dejar de trabajar de por vida o si vamos a seguir haciéndolo por placer.

Ni siquiera en materia sexual podemos aislar la fantasía de su contexto. No manejamos el delirio abstracto. Si soñamos con un hombre, necesitamos saber –como mínimo- a qué se dedica, cómo nos conocimos, y qué sentimos por él. Sin aclarar ese panorama, las fantasías pierden atractivo. Son como una película pornográfica muy tirada de los pelos que nos deja insatisfechas.

El momento predilecto para pensar tonteras es por la noche, antes de dormir. Mientras encontramos la posición ideal de la almohada, la mayoría de nosotras empieza a esbozar los primeros trazos de un delirio somnoliendo parecido a los libros de Sidney Sheldon. Cada una elige su propia aventura. Algunas hacen escarmentar a su jefa, otras se acuestan con un compañero de facultad, otras le roban el marido a la hermana, y algunas se animan a ganar el Oscar.

Tan minucioso es el desglose de escenas y el pulido de los detalles, que muchas veces nos quedamos dormidas antes de empezar a fantasear, cuando todavía estamos preparando el trasfondo de la historia. Si tenemos una fiesta, por ejemplo, la pre-vivimos veinte veces. Recorremos todos los desenlaces probables con tanto esmero, que difícilmente nos llevemos una sorpresa el día del evento.

Este vicio, sin embargo, tiene efectos colaterales que nos perjudican. El primero es que se multiplican los planteos hipotéticos que le hacemos a los hombres: “Si yo me muriera ¿Con cuál de mis amigas te casarías?”, “Si tuvieras un millón de dólares, ¿en qué los gastarías?” “Si llegamos a viejitos juntos, vos preferirías: A. Morirte primero. B. Que me muera primero yo. C. Que nos muramos juntos en un accidente de tránsito”.

El segundo, es que tenemos miedo de que se nos suelte el último cable conectado al sentido común y se nos borre el delicado límite que separa la realidad de la ficción. Que un día, presas de un delirio romántico, entremos al aula de la universidad vestidas de novia, con todo el maquillaje corrido, a decirle que sí, que nos vamos a casar, a un profesor que apenas si retiene nuestro apellido.

Contra lo que pudiera parecer, este nivel de ensoñación no merma ni con romance ni con billetes. Las fantasías no son, para nosotras, un placebo. Son una forma de vida. Cuando estamos enamoradas, igual soñamos con tener una aventura escandalosa con otro hombre o con hacer escarmentar a un ex novio por indiferente. Nos motiva la venganza. Nos encanta pensar que abandonamos a nuestra pareja (contador, gordito, hipocondríaco) cuando inesperadamente conocemos a un neurólogo valiente del Chicago County Hospital (pintor torturado o empresario italiano también valen) y nos fugamos con él, dejando al gordito hecho pedazos, llorando arrepentido por no habernos acompañado a ver vidrieras o levantado sus propias medias del piso. Si mi abuela supiera, diría que se nos volaron todos los pájaros. Yo, en cambio, prefiero pensar que hacemos justicia.

174 comentarios:

ITZPAPÁLOTL dijo...

Tengo un blog y no escribo mucho en él, pero el punto aqui es que estaba por escribir algo similar(*.*lo juro!!), cuando estoy en el trabajo me imagino a todas las personas de la oficina, y entre esbozos de todo lo que sé acerca de ellos elaboro simulaciones de sus personalidades en mis fantasias, platico con las simulaciones y pienso en las posibilidades que existen si una palabra pequeña y sencilla cambia de lugar o es sutituida por un sinónimo, probablemente los pajaros fugitivos sean meramente humanos...

bravo!! por eso su blog esta en mis favoritos :)

ITZPAPÁLOTL dijo...

Sabe que señorita bestiaria?? Tengo un blog y no escribo mucho en él, pero el punto aqui es que estaba por escribir algo similar(lo juro!!), cuando estoy en el trabajo me imagino a todas las personas de la oficina, y entre esbozos de todo lo que sé acerca de ellos elaboro simulaciones de sus personalidades en mis fantasias, platico con las simulaciones y pienso en las posibilidades que existen si una palabra pequeña y sencilla cambia de lugar o es sutituida por un sinónimo, probablemente los pajaros fugitivos sean meramente humanos...

bravo!! por eso su blog esta en mis favoritos :)

ITZPAPÁLOTL dijo...

Sabe que señorita bestiaria?? Tengo un blog y no escribo mucho en él, pero el punto aqui es que estaba por escribir algo similar(lo juro!!), cuando estoy en el trabajo me imagino a todas las personas de la oficina, y entre esbozos de todo lo que sé acerca de ellos elaboro simulaciones de sus personalidades en mis fantasias, platico con las simulaciones y pienso en las posibilidades que existen si una palabra pequeña y sencilla cambia de lugar o es sutituida por un sinónimo, probablemente los pajaros fugitivos sean meramente humanos...

bravo!! por eso su blog esta en mis favoritos :)

olivia dijo...

que hermoso que alguien ponga en palabras exactas algo que he tratado de explicarle por todos los medios a mi novio.
tienes razon con lo del trasfondo. a veces me demoro tanto en pensar como fue que edward norton y yo nos conocimos que me pierdo la mejor parte mientras me quedo dormida.

Salve! dijo...

Asombroso, Carolina. Has entrado en mi mente y sacado tal cual todo lo que rebulle en mi personalidad de mundo paralelo "de toda la vida". Tal cual, con su detalle paranoico. Me ha gustado en especial ese párrafo sobre preparar el trasfondo de la historia y quedarse cuajadita antes de empezar a disfrutarlo... En cambio, tu última conclusión no me seduce tanto. Para mí no es una cuestión de justicia vengativa, es puro vicio perfeccionista!

Ariana Aaron dijo...

Coincido.

Y el nivel de ensoñación no merma con la edad tampoco.

manhattan transfer dijo...

A los hombres nos pasa lo mismo Carolina. Pero a casi ninguno se le ocurre comentarlo. A los sueños de amor y dinero debemos agregarle el de jugar de número 10 en la Selección o en Boca y hacer un golazo en la final. La minuciosidad está presente: cómo encontramos ese dinero, cómo fuimos yendo al polvo clandestino con esa amiga de nuestra pareja, cómo la pisamos, amasamos y pateamos hasta conmover la red del arco contrario. Todas estratagemas para creer que la vida es linda. Si no existieran esos momentos de sueño sería una cagada. Es verdad, la vida es sueño.

Laurinha dijo...

Bien, Bestiaria, totalmente identificada.

A prop, se extrañaba.

Saludos

Stacy Malibu dijo...

Qué bueno es saber que no soy la única que tiene una pyme de pavadas en su cabeza...

Excelente como siempre!

Se Armo La Gorda dijo...

Jajaja!

Bueno, confesar esto de soñar despierta es algo que me pone los cachetes colorados!

Pero ya que estamos, soñemos que somos todas gordas coquetas sentadas con una bandeja vacía de biscochitos y unos mates medio frios...

Yo siempre sueño que me entrevistan como a una Diva de Joligud! Y me invento mil respuestas...Y mil vidas, obviamente! Me pregunto lo que me gustaría que me pregunten...y sueño-vivo cada gesto y cada respuesta...

Apapachos,
La Gorda.

http://searmolagorda.blogspot.com

Anónimo dijo...

¡Excelente Carolina! Lo que me pregunto es por qué soñamos la novela de amor cuando estamos solas y el viaje (que realizamos solas, siempre solas o a lo sumo con amigos) cuando estamos en pareja.
María.-

Laura dijo...

Esto es una verdad reveladora. Siempre pensé que yo era la única loca. Ahora me siento mejor!

caro delpy dijo...

Es tan verosímil lo que decís que muchas veces, "una" fantasea con ser la única, la de las características diferentes y encantadoras ante los otros. A veces siento que tengo varias personalidades y que actúo. Sin ir más lejos durante la última discusión con mi marido en la que por supuesto le planteaba opciones ridículas, le dije las ultimas 7 palabras hirientes, me fui al baño, me miré al espejo y me sonreí recordando a Bette Davis en "Qué Fue de Baby Jane". Así somos.

caro delpy dijo...

Es tan verosímil lo que decís que muchas veces, "una" fantasea con ser la única, la de las características diferentes y encantadoras ante los otros. A veces siento que tengo varias personalidades y que actúo. Sin ir más lejos durante la última discusión con mi marido en la que por supuesto le planteaba opciones ridículas, le dije las ultimas 7 palabras hirientes, me fui al baño, me miré al espejo y me sonreí recordando a Bette Davis en "Qué Fue de Baby Jane". Así somos.

caro delpy dijo...

Es tan verosímil lo que decís que muchas veces, "una" fantasea con ser la única, la de las características diferentes y encantadoras ante los otros. A veces siento que tengo varias personalidades y que actúo. Sin ir más lejos durante la última discusión con mi marido en la que por supuesto le planteaba opciones ridículas, le dije las ultimas 7 palabras hirientes, me fui al baño, me miré al espejo y me sonreí recordando a Bette Davis en "Qué Fue de Baby Jane". Así somos.

Anónimo dijo...

Como dice manhattam no es exclusivo de mujeres. Yo siempre he creido que tenía esas fantasías por mi incapacidad de saber que quiero exactamente en la vida. Soy el hombre que sabe un poco de casi todo, pero no sabe mucho de nada. Una especie de diletante del saber con metas poco definidas.

También me suelo quedar dormido a la mitad. De hecho no puedo dormir dejando la mente en blanco como hace mi mujer, tengo que dormirme fantaseando, siempre.

Saludos para todos.

Rodin.

Chirli dijo...

Pienso como usted señorita, me pasa lo mismo que el primer comentario que le han dejado.

Besos grandes

Lilyth dijo...

Nunca deja de asombrarme la exactitud que tienes para encontrar palabras que describen mis vivencias y por supuesto las de miles de mujeres mas... ¿sabes?... estoy pensando que cuando quiera que alguien me conozca le dire, "entra al blog de Bestiaria y lee esta lista de post, luego hablamos".... jajajaja

Vale dijo...

Una vez mas, Carolina, reflejas lo que nos pasa a muchas. Esa costumbre que vivimos dia a dia en carne propia.
Conoces a alguien y una ya empieza a tejer escarpines ...PARA LOS NIETOS QUE VAN A TENER!!!
Espero con ansias tu proxima entrada... asi como vengo esperando todas desde q cai "accidentalmente" en tu blog.

Ceci dijo...

Me encantó!!! Sus palabras describen tan exactamente fases de mi vida que, pienso, tal vez nos conocemos y no me he dado cuenta...

Con respecto al tema de las fantasías, en una época ocupaban tanto tiempo mi cabeza que llegué a sentir culpa. Hoy, siento culpa de no tenerlas, juro que es así, me acuesto, trato de poner la maquinaria de ensoñación en funcionamiento, y no pasa nada. Se me vació el saco de fantansías... No sé qué me pasa. Compensa el hecho de ser feliz en la realidad?

Nuevamente, gracias por sus palabras. Si ud. me autoriza, me gustaría linkearla desde mi blog.

Slds.

Virginia dijo...

Nada tan parecido a mi realidad (o mi ficción... ya no lo sé). Sumo otro disparador de fantasías. Las nuevas posibilidades de algo: mudarse, ir a una entrevista de trabajo, planificar un viaje, tener una cita, comprar un billete de lotería, etc. Todo eso me genera un aluvión de pavadas acerca de lo que va a suceder o de lo que me gustaría que ocurra. Mi psicóloga me dice que soy un poco obsesiva, y cuando le manifiesto miedo, que me adelanto negativamente al futuro. Mi novio me dice que pienso demasiado y que pierdo el tiempo del "hacer" en "pensar". Siempre dudé acerca de mi grado de locura, pero desde ahora "prefiero pensar que soy inocente y cursi como una heroína de folletín", como vos decís.

Silvina dijo...

Jajajaja, Chicago County Hospital!
Cuántas veces habré soñado que me casaba con el Dr. Carter...

Dramatic Coffee dijo...

Nunca mejor descripto, Bestiaria. Daydreaming rules.

Ya puedo escuchar gritar a más de una lectora identificada: "¡Pensé que era la única!"

No, no estamos solas.

Saludos!



http://dramatic-coffee.blogspot.com

Anónimo dijo...

A bueno, yo no sueño con Manhatan yo sueño con irme a Brujas, por ejemplo o a Oceanía, y si, perfecto tu relato Carolina, como siempre, me siento a veces identificada por soñar despierta, pero lo hago de dia, camino al trabajo por ejemplo, sueño que haria con 1 palito verde...no es de millonaria, pero siempre me sale el espiritu emprendedor, empiezo a fantasear como los invertiria a tal fin de que eso me haga ingresar mas billetes a mi cuenta en las canarias! a la noche antes de quedarme dormida, ni lo pienso, estoy demasiado ocupada con mis paranoias diarias, y al otro dia se me esfuma todo lo que habia predestinado para ese dia! ni se pór que me hago tanto la cabeza, despues al final hago cualquier cosa...
Por cierto se te extrañaba, soy una fucking paranoica entro a toda hora para ver si publicaste...AHHH vi de paso, el nuevo adelanto del proyecto de Lanata, ahi vas a estar vos? o yo entendi como el culo? Me mato si no es asi!

Lilis dijo...

Ahhh noo!!!
Pero de verdad todas las mujeres hacemos eso?
Nunca me habia atrevido ni a comentarlo con una amiga por miedo a que me tomen de boba.
Me imagino en viajes, amores, que estoy en la casa de Gran Hermano, me imagino dueña de mi empresa, me imagino separandome de mi novio, y casandome con el... Ahh! Puedo decirlo! A todas le pasa lo mismo! Gracias!
Me encanta tu blog! Es como una de descripción mi, y evidentemente de toda mujer!

reinadecapitada dijo...

tampoco creo que esto sea "privilegio" de mujeres, o que las mujeres soñemos así y los hombres asá. cierto que la Tv. y el cine porno se dirigen a la mentalidad masculina y logran fantasías abusrdas. pero bueno, cada cual es absurdo a su modo.

david lynch captó muy bien esta tendencia imaginativa como forma de compensar la vida diaria. mulholland drive, obra maestra, es el perfecto ejemplo en el que una mujer sueña su vida perfecta con trabajo perfecto, novia perfecta y venganza de quienes le hicieron daño. pero el sueño puede convertirse en locura.

guayi dijo...

la imaginación es una de las mejores armas que tiene el ser humano, para evadir la realidad, para disfrutar mas, para vivir, cada uno a su manera habla solo, piensa proyectos perfecto...
Ser soñadora es la mejor parte de mi vida un mundo que yo manejo y no tengo porque dejarlo!!!!

yerbanohay dijo...

yo soy peor que eso, cada vez que cocino, me imagino que estoy en el programa Utilisima...
y cada vez que quiero hacer sufrir a un tipo me imagino que estoy en una cama al borde de la muerte(claro que al ultimo zafo) y el tipo esta ahi, muriendose del dolor, hecho pelota..!
Son fantasías, tambien, es como que cuando voy caminando por la calle me imagino que estoy pasando ropa en una pasarela, sobre todo si el viento me levanta el pelo. Somos de terror las minas!

Francisco dijo...

Fantaseo como mujer.

Anónimo dijo...

Simplemente genial Caro . Me FA SCINÓ esta nota.
Sigo riéndome , aunque también emocionada. Eso, saber que alguien , una mujer, puede poner en palabras la PURA verdad , por el amor de dios!Tal cual, a la noche, en la cama a punto de desfallecer, lucubro teorías conspirativas de mi propia vida , y pienso que soy kate y que me debato entre saywer y jack.
Tengo problemas serios, es cierto.

Besos,
Mery H.

Anónimo dijo...

Simplemente genial Caro. Me FA SCINÓ esta nota. Sigo riéndome, aunque también emocionada. Eso, saber que alguien-una mujer- sepa poner en palabras la pura verdad! Tal cual, a la noche, en la cama antes de desfallecer, lucubro teorías conspirativas de mi propia vida, y me creo kate , y que me debato entre saywer y jack.
Tengo problemas serios, es cierto.

Besos,
Mery H.

Anónimo dijo...

La verdad, pense que era una loca porque este post me identifica de una manera increible!! pero ahora me doy cuanta de que todas las mujeres estamos locas y ME ENCANTA!!
Hablando en serio, muy buen post, muy buen blog! felicitaciones Carolina, un placer leerte!!
Besos

Anónimo dijo...

Tal cual!!!

Ayer dejé las muletas después de dos meses (saliendo poco y sin ir a trabajar) y me he covertido en una profesional del asunto!!! Y no pienso parar!!!

Saludos, Laura Merengada

Grace dijo...

Los hombres hacen lo mismo. Sueñan que entran en la cancha con su equipo favorito o que les llueve dinero. Lo que es verdad que nosotras le ponemos moños.
Hacerlo de noche tiene sus complicaciones porque nos vamos "trenzando" de tal manera con nosotras mismas, no podemos dormir y armamos una telenovela sin final que nos carcome la cabeza. Cuando amanece, la luz de día nos da alivio.
Siempre imagino que me hacen reportajes. Tanto gráficos como televisivos.
Que me gano algún premio literario importante. O que voy a una gala con alguna reina.
Maravilloso! Hay que seguir haciéndolo, sólo con algunos cuidados.

Cyllan dijo...

Coincido completamente contigo.
Y creo que, en eso de que necesitamos justificar desde el comienzo el romance u otra fantasía que ocurre en nuestra imaginación, se esconde el porqué de que las mujeres no disfruten con el porno como los hombres.
¿Alguien se cree que haya una chica trabajando en una gasolinera que esté tremendísima y que puede hacerte un francés en el túnel de lavado?
Nosotras imaginamos a un empresario aburrido que se enamora de nuestra risa en un café y decide aparcar su monótona vida para hablar un instante con nosotras, lo que basta para descubrir que somos la mujer que siempre habían deseado. Luego vendrá el sexo. Y será fantástico. Porque será, a nuestro modo, creíble.

neurotransmisores dijo...

Muy interesates los comentarios del post. No sabía que las mujeres y por lo visto en los comentarios algunos hombres dedican mucho tiempo de su vida a la ensoñación.

Anónimo dijo...

genial, y mi opinion es una suma del resto. pusiste en palabras algo inexplicable.
hasta creía que soñaba despierta más de lo normal, pero veo que soy muy normalita. hasta siemrpe tengo miedo del segundo efecto colateral de soñar tanto.
un gusto haber encontrado este blog!

Alicia Spraggon dijo...

Bestiaria: la entrada al aula de la Universidad vestida de novia me mató! Buenísimo tu post.

vamosabrillar dijo...

Y obvio que también me imagino peleas dramatiquísimas, siempre en un bar, pero todavía no puedo decidir si tiro un vaso al piso con furia y los vidrios saltan por todos lados o si le tiro el agua en la cara.

Anónimo dijo...

http://televisame.blogspot.com

mary vansinne dijo...

me da mucha culpa hacer eso, pero ni se me ocurre plantear dejar de fantasear en mi cabeza.. mientras qe la realidad sea 'mejor' jajaja
muuuuuuuy buen texto

Anónimo dijo...

A mi me pasa lo mismo, desde chiquita (cuando soñaba que Xuxa me elegia para ser paquita), y tambien creia que era la unica, y nunca me anime a contarselo a nadie. Ahora mis sueños son casi todos novelescos, con distintas y elavoradas tramas, pero en todas ocurre algun acontecimiento que hace que el chico que me gusta se enamore perdidamente de mi y yo lo dejo a mi marido y me caso con el. Lugares preferidos para soñar: el colectivo o caminando por la calle. Una preocupacion real que tengo es que un dia me pise un colectivo por ir tan distraida !

Catus Desesperaos dijo...

Como cactus que soy, y por tanto debido a mi ambigüedad sexual, me posiciono más cercano a las mujeres que a los hombres. Vosotras nunca entraríais en guerras, compráis más cactus y además tenéis más sensibilidad para regarnos.

Buenísimo tu blog. De veras

Saludos. Ocúltate cuando llegue la invasión

TCC

Anónimo dijo...

Que bueno poder leer algo así, la verdad que me siento re bien de saber que no soy la única que se desvela con las fantasías y cuentos inventados.

Quiero acotar de que además de tener infinitas historias de amor hechas en mi mente, tengo también muchas de discusión, sea con mi pareja, jefe, salidor, etc. en las cuales siempre tengo las palabras correctas y perfectas. Soy una especie de experta en la oratoria, es como que me quedo con la última palabra y encima dejo un buen mensaje para la humanidad jajaja.

Que bueno poder compartir esto. Gracias.

RED FISH dijo...

Concuerdo en que los hombre somos menos soñadores.
Sin embargo yo siempre pensé que prefero morir primero. Y este lindo post me dio ganas de escribir al respecto. Si alguien quiere conocer mi pensamiento están invitados a visitarme.
Sds, RF.

vamosabrillar dijo...

Che, había comentado largo y tendido sobre mis fantasías, un comment antes de lo de las peleas, no llegó o no lo publicaste?

Deb dijo...

ggggguuuuuuuaaaaaauuuuuuu! Pero no de ladrido sino de qué bueno... También tengo un blog, pero ya te habrás hartado de escuchar eso. Me pasó tu blog una amiga y es realmente todo un éxito esto che... Ojalá alguna vez llegue a tener tantos comentarios como vos! Estás en mi lista de personas que ponen todos los sentidos en lo que escriben y que, supongo, disfrutarás de eso igual que yo cuando me animo a publicar algo... No jodo más, nos vemos... (justo estoy leyendo a Calderón de la Barca jeje)

Carolina dijo...

vamosabrillar:

si no está acá, es que no llegó. Yo sólo borré spam tipo "chicas desnudas en chicasdesnudas.blogspot.com"

Barbie dijo...

EXCELENTEEEE! Nadie hizo jamás una descripción exacta de mi forma de soñar. Te agrego que sueño cuando viajo en el colectivo, y cuando camino hacia el trabajo... Elijo el auto que me compro con la plata que me gane y discuto conmigo misma si el dpto para mis hermanos se los doy antes de los 25 años. Quienes son los beneficiaros y hasta he sumado el monto de las cosas que quería hacer para ver si me alcanzaba la plata y establecer prioridades.
Im-pe-ca-ble!!! Siempre un placer visitarle

vamosabrillar dijo...

Uy, qué lástima, pensé que por ahí se te había pasado, porque no sé cómo es que llegan cuando hay moderación.
Decía que nunca en la historia de Bestiaria me sentí TAN identificada como con este post. Todas las noches me imagino casada con mi novio, en una casa increible, que decoré y amueblé con un gusto impecable y que ya conozco de memoria.
También pienso en nuestros hijos, pero claro, me imagino sus edades, sus nombres, cuánto se llevan entre ellos, a qué edad los tuve, a qué edad quedé embarazada y cuándo quiero tener el próximo, como para que todo encaje. También fantaseo con que mi marido se va de viaje de negocios y yo me entero que estoy embarazada, y no puedo decidirme entre llamarlo o esperar a que llegue.
Después me imagino que nos vamos de viaje, pero claro, con o sin hijos?Hay que mantener cierta coherencia. Si vamos sin ellos pienso dónde y con quién los dejamos. Planeo el itinerario y me imagino hasta los cuartos de los hoteles. No voy a ciertos lugares porque van a estar llenísimos de turistas y prefiero ir en unos meses.
Pienso en mi trabajo, en qué tengo que hacer ese día, y si justo ese día lo tengo libre pienso por qué.
Tengo toda una vida armada, no paralela, sino futura. Lo único que me falta resolver es dónde queda esa casa, cosa que me tortura todas las noches.
Y también como vos, hasta que leí este post, pensé que era la única y me sentía genial y especial por tener tanta vida interior.

Gi dijo...

Hola!
No puedo creer la exactitud de lo que escribis.
Me siento re identificada con todo lo que describis.
Creo que en eso de soñar es muy cierto el hecho que no se nos puede escapar ni un detalle, es tal cual!!
A veces tb le agregamos musica a los sueños.-

silvina dijo...

Jajaja!! No puedo creer lo que acabo de leer, te juro que a mis 36 pensaba que era la única tarada que lo hacía!!! Gracias!!!Sos una genia!

Susana dijo...

ME ENCANTÓ!!! Sueño desde que tengo uso de razón. Sueño dormida, antes de irme a dormir, cuando me despierto, cuando en el trabajo debo apaciguar una situación tensa sueño con darle una buena trompada al que me está amargando ese momento, pero sobre todo tengo dueños de amor, que de tanto darme manija alguno se me ha hecho realidad!! Es increíble soñar durante años con reencontrarte con un viejo amor y poder realizar ese sueño!! Si alguna/o vivió esta situación sabe de lo que estoy hablando...
De paso les comento que estoy comenzando un blog, los invito a participar: http://www.reputaciondudosa.blogspot.com.
Caro felicitaciones por Bestiaria, es magnífico.
Susana

Anónimo dijo...

mando y mando y no aparece mi comentario :(

era que yo le pongo audio... hablo sola en voz alta
recreo situaciones que ya vivi, se me ocurren las contestaciones mas brillantes,

Maru dijo...

Que alivio! asique a todas y todos (segun comentario de caballero) nos pasa lo mismo... que felicidad!
ahora, yo pregunto: cómo hacemos para disimularlo tan bien??
Yo por mi parte paso la mayor parte del día alusinando pavadas, pero sin lugar a dudas, como vos decis, mientras acomodo la almohada es el mejor momento. Lo mejor es dormirse soñando y la noche siguiente seguir donde una se durmió, como si fuera por capítulos!
Besos y gracias!

Maru dijo...

Que alivio! asique a todas y todos (segun comentario de caballero) nos pasa lo mismo... que felicidad!
ahora, yo pregunto: cómo hacemos para disimularlo tan bien??
Yo por mi parte paso la mayor parte del día alusinando pavadas, pero sin lugar a dudas, como vos decis, mientras acomodo la almohada es el mejor momento. Lo mejor es dormirse soñando y la noche siguiente seguir donde una se durmió, como si fuera por capítulos!
Besos y gracias!

Rayuela dijo...

Excelente Post. Creo, es mi favorito. A mí me pasa exactamente lo mismo, pero no antes de dormir, sino en el momento de ensoñación que hay entre que suena el despertador la primera vez y hay que levantarme. Pensé que yo era la loca, me da gusto saber que es un mal común.

Saludos. :)

Little Queen dijo...

ay menos mal que no soy la unica.

Carolina dijo...

chicas, yo también pensé AÑOS que era la única.
Pero un dia encontré el diario íntimo de una amiga. Y era un papelón. Parecía Dinastía. lleno de delirios!

Anónimo dijo...

¿Leíste el diario íntimo de una amiga? mmmm muy mal, eso no se hace.
(Lo que no se hace es escribir diarios íntimos y dejarlos por ahí jajaja).

Qué paranoicas somos todas por dios! Yo siempre imagino que me muero y a quienes me llorarían en la tumba. Qué placer horrendo!
Excelente post, y el dibujito también me encantó. ¿Mansilla?

Saludos!
Pupi

Alma dijo...

Eso mismo, yo pense que era la unica, ya veo q no.

pero nadie, me incluyo, va a confesar nunca que perdio varias horas de sueño imaginando posibles escenas...que seguro JAMAS sucederan.

NO se vivir de otra manera!


Saludos!

persis dijo...

Algunas hemos escrito cuentos y novelas desde esas fantasías. Vale la pena cultivarlas desde lo literario antes de que se transformen en patologías.

Liz la rutilante dijo...

TAL CUAL!!!!

Me sentí tan identificada con este post que hasta me dió escalofríos. Y yo que no me considero una mina "femenina" para nada, nunca encajo en los test, los estereotipos no se me acercan ni un poquito... pero esto, Dios mio, tal cual. Es bueno saber que es una tara femenina y no una enfermedad mía.

Una de mis mejores historietas fantasticas era de cómo conocía a Leo Sbaraglia (totalmente verosímil, demas esta decir) y nos terminabamos ultraenamorando. El de mí más que yo de él. Y hablaba de mí en las revistas, y... en fin. Excelente el post

Pegame y decime Sheena dijo...

Ayyyy!! parece que me pintás de pie a cabeza. Vivo soñando pavadas, y a veces me da una rabia, porque en lugar de estudiar me encuentro que estoy imaginando que hubiera pasado si yo hubiera dicho tal cosa, y lógicamente todo termina en un beso de telenovela cuando los apuntes de la facultad siguen intactos y yo rindo en un lapso de nada. También muchas veces fantaseo mientras estudio que mientras doy el oral hay alarma de bomba, se incendia el edificio o alguna cosa semejante y me imagino a toda la clase huyendo en vez de dedicarme a lo más probable, a que seguro no pasa nada y el examen lo toman igual. Los que más me sorprende es mi capacidad de imaginar peleas con alguien, las cosas que digo y que el otro me mira con cara de tenés razón, y si por casualidad se me ocurre tirarle a esa persona en la realidad un párrafo de lo que imaginé me responde algo totalmente diferente a lo que yo había pensado...
Estoy muy loca o soy mujer?

Jorge Ampuero dijo...

Interesante blog. Espero pasar seguido y nos leamos.

Besos...

Paradoja Humana dijo...

Muy bacana la columna, por fin leo a alguien haciéndole total justicia a la habilidad que tenemos las mujeres para armarnos películas tan completas en torno a cualquier tema.

Mofi dijo...

acabas de desvelar uno de nuestros más oscuros secretos!!!

Liz la rutilante dijo...

sheena, me hiciste acordar de las miles de películas que me hice en mi epoca universitaria, antes de ir a rendir cualquier materia que tuviese floja! Una de las mejores era una en la que abría la puerta de mi casa para ir a la facultad, y se me caía encima un tipo acuchillado cuyo asesino había dejado apoyado en mi puerta del lado de afuera.

Perdon, pero esto de los sueños me mató!

histeriaperruna dijo...

Concuerdo contigo!!

Siento que si te cuento todos mis quilombos de mujer los solucionarias!

la autora dijo...

Yo creo que con los años, una, encontra de todo pronostico, exacerva esas fantasias. cuando una es chica, las tiene si, pero de grande, que jugosos todos los detalles que le podes agregar! Porque cuando a los 8 años simplemente queriamos: casarnos de blanco. Ahora ya sabemos que queremos casarnos de blanco, cuantos invitados habra, quien se sentará con quien, como sera nuestro vestido dependeiendo del cuerpo, A QUE GIMNASIO IREMOS A BAJAR ESOS KILOS DE MAS Y QUE RUTINA NOS CONVIENE, (a mi sin lugar a dudas esa que te meten en una capsula con mucho calor, entocnes lo que haces en 20 minutos es como si hicieras 1 hora en gimnasio comun), el destino de la luna de miel, la profesion de tu furturo marido, cantidad de hijos y posibles nombres..es agotador.
Cuando apenas conozco un hombre, anque nisiquiera le haya dado un beso o haya comrpobado si me gusta o no, ya imagino: donde y cuando me va a proponer matrimonio, donde vamos a vivir, quien va alavar los platos y cocinar y lo mas importante: el motivo por el que mi suegra me va a odiar.

en mi blog, abierto recientemente, pienso tratar algun dia estos temas. mientras me pregunto: donde esta cupido?

unwanted dijo...

excelente post. Que lindo que es saber que no soy la unica que le pasan estas cosas...

Anónimo dijo...

Si bien no acostumbro decir cosas del tipo "ay, sii me sentí re identificada!!" o "me describiste tal cual soy!!" y esas cosas, como tampoco me siento reflejada con algún estereotipo en particular ( o quizás tengo un poco de algunos, y otro poco realmente inclasificable ), sepa que este post me generó una serenidad indescriptible mientras lo leía, o al menos acompañada y conmovida por diversos párrafos de ese post que pintaron esa vieja manía que tengo de pasar gran parte del tiempo soñando despierta.

Siempre pensé que esa incomprendida y subestimada costumbre de "pensar pavadas" la mayor parte del tiempo, se asociaba más a una patología preocupante que a una ancestral costumbre femenina más ( y veo que de algunos hombres también ).

Sublime post. Sigo enteramente conmovida :)

Kar

Lucía.uy dijo...

Llevo bastante navegando por Internet, y me doy cuenta, que cada vez,cuesta mucho más escribir o encontrar, artículos originales.

Más allá de estar de acuerdo en un todo contigo, yo diría en 1000 todos contigo, noto que para lograr esa originalidad, estamos dispuestos a mostrarnos tal cual somos en esa otra originalidad, que somos cada uno de nosotros; y ahí, nos damos cuenta que tampoco somos muy originales.

Para muestra, basta tu artículo! jajajaja.....del cual debo decir que te expresas como las Diosas!

Me alegro haberte encontrado.

Un gran abarazo. Lucía

Anónimo dijo...

pero que tranquila me dejan tus palabras bestiaria... yo que pensaba que me estaba volviendo loca,jajaja y no, somos varias las q estamos en la misma.
es q soñar despierta, es un visio dificil de dejar, en lo q mas me siento identificada, es en q de tanto pensar en los detaller, el sueño puede estar listo como en varios dias jaja
besitos desde Chile

Charlie dijo...

Yo flasheo que fui miembro de los marines o un grupo comando, o de la legion extranjera.
Y que soy un groso del combate, una maquina de matar, pero medio traumadito por la guerra y que una hipotetica novia me agarra la mano cuando me dspierto teniendo pesadillas o algo asi.

O que tengo una p*** ASI de grande!

Que fui huerfano y vivi una vida marginal, o que soy como "el pollo"
de Okupas, que soy alto chorro de bancos como el gordo Valor y la garza Sosa.

Que soy musico e invento unos temas buenisimos y todo el publico canta y salta, que soy un capo de la lucha "vale todo" y les pateo el culo a todos.
Aaahhh q groso!

Que soy el intendente de buenos aires y arreglo todo y hago mucho subte nuevo y convierto a buenos aires en una ciudad linda.

O mejor, que soy el presidente y saco el pais adelante.
y les pateo el culo a todos.

Bestiaria Rules!
Saludos!

Tarso dijo...

Hola, primera vez que entro a tu blog y me encantó este post, cierto que cada loco con su tema pero que bueno es tener los pajarillos anidando en la cabeza. Super precisa y super volada. Felicitaciones y muy bien 10.

Anónimo dijo...

Claro, ahora me cierra todo... todas padecemos lo mismo, sólo que algunas creemos que somos unas orates descerebradas y lo ocultamos y otras, mucho más astutas sin dudas, se convierten en Amanda Ashley,Johanna Lindsey,Diana Palmer,JR Wards, Jude Deveraux...

Anónimo dijo...

Que interesante blog, tal vez tan interesante como las mismas mujeres. Pero tambien los hombres fantasiamos, todos los dias. Y no por cosas como ganar la loteria, aveces simplemente re-vivimos (re-editamos) nuestro pasado; por ejemplo Que hubiera pasado si hubieramos recojido lo toalla del piso, acaso eso hubiera salvado mi relacion? o tal vez si le hubiera dado los aretes que tanto le gustaban. Es decir, querremos editar nuestra propia vida.

.::Terrenal::. dijo...

HOla caro! siempre q paso es un placer. muy bueno nena!

Te dejo mis saludos!

Anónimo dijo...

Y hasta ahora yo me creía tan especial. Estaba convencida que era la única súper soñadora.

Oh, que común y corriente somos y no nos damos cuenta.

loretto dijo...

No sé, si ya salió, lo borras. pero he quedado con la sensación de ser común y corriente ... y me encanta. Hasta hace un rato yo pensaba que era la única volada que todas las noches decoraba mi ensueño y me dormía antes de la salida de los protagonistas (es decir él - quien escogía con pinzas - y yo por supuesto)

DiegoS dijo...

Que locura, no dejo nunca de sorprenderme. La fantasía y las contrucciones imaginarias son condicones comunes, los hombres soñamos todo el tiempo, pero que lejos estamos (o estoy yo por lo menos) de soñar con ser un exitoso neurologo(!) de Chicago, o empresario italiano. Cuando cierro los ojos para dormirme, hago por lo menos un par de goles, va ... eso era cuenda era más jóven, ahora sólo doy el pase. Los hombres hacemos goles o brillamos con nuestra guitarra eléctrica, aunque tengamos la desgracia de ser neurólogos o empresarios.

Sunshine dijo...

Saludos, hacía mucho que no pasaba por acá.... no entiendo por qué..

Liza dijo...

Gracias! Me ahorraste la terapia...(otra vez)Pensé que era la única loca que tenía una vida paralela - varias en realidad - desde que tengo memoria. Y cada vez las historias se van complicando más porque le agrego personajes de películas,libros, y de programas de tv. Y juro que he tenido momentos de panico imaginandome que perdía totalmente la chaveta y no distinguía la realidad de mis fantasías... lo cual disparaba otra fantasía que ni te cuento. Sos una maestra!

Anónimo dijo...

los comentarios ya no son lo que eran. Antes entraba a leer los comentarios con el mismo interés y entusiasmo que los artículos.
Qué pasó con los comentadores/as picantes??

la claquetista dijo...

Un aplauso para la exactitud con la que has descripto nuestras(o, por lo menos, mis) fantasias.
En fin, mientras te leía pensaba en que justamaente me encuentro estudiando melodrama, género que se caracterza por la preponderancia de los sentimientos exacerbados de las mujeres. Pensaba en mi, en vos, en las heroínas melodramaticas...en fin...fantaseaba nuevamente

Paradise dijo...

Hola, muy bueno tu blog y este post en particular.

Yo pienso que para soñar no hay que diferenciar en genero, si no mas bien en la realidad que cada uno este viviendo. Se pueden soñar cosas totalmente traída de los pelos o algo racional de principio a fin pero más alla de ello lo que debemos rescatar es que toda esa ficción fue creada por nuestro subconciente y vale mucho.

Saludos!!

Anónimo dijo...

Yo tambien siempre pense que era la unica loca. Y ahora me siento realmente mucho mejor!!!!

jajajaja

Excelente articulo!

Anónimo dijo...

Genial la imagen del gorditooo, pobre. Si, identificación total y el alivio de no sentir tantas contradicciones al fantasear com otros equis que navegan como fantasmas en mi cabeza, y estar enamorada de mi chico de carne y hueso...
muy bueno el post-posta

ceci dijo...

segun lo que este escuchando en el colectivo, soy lilly allen, soy francoise hardy, soy morrissey, soy javi mena, soy pete doherty, y siempre se enamoran de mi mientras estoy en el """escenario"""
saludossss

Anónimo dijo...

Increíble lo exacto del post, los detalles, todo, todo es así. Y qué bronca cuando nos dormimos antes de haber dado ese beso, o de haber dicho la frase que iba a dejar a nuestro jefe bien puesto en su lugar!!!

Hace un tiempo me pregunté lo mismo. ¿Seré yo sola? pero bueno, no, ya veo que somos todas.

Genial, bestiaria, como siempre.

Anónimo dijo...

Si, soy soñadora, y si, pense que era una cosa de mi caracter, me equivoque.
Es divertido pensar que mientras yo me imagino enamorando perdidamente a un guapo pintor veneciano a mitad del día, hay millones de mujeres que imaginan lo mismo a la misma hora...
Y claro, la cosa no es llegar y besarlo, primero tiene que tropezar conmigo y tirame las compras

Sea&Sun dijo...

Qué emoción!! :D wiii! no soy la única que vive soñando.
Me sentí reflejada cuando dijiste lo de los oscars (qué algún día ganaré o.O) y los viajes algún dia haré y las aventuras que algún día tendré (aunque eso ultimo prefiero dejarlo en sueños)...
Amo leerte *0* tienes un talento especial para decir exactamente lo que nos pasa.

Sldz Bestiaria! :D

Anónimo dijo...

yo sueño que soy la persona mas inteligente del mundo y encuentro las curas a enfermedades como cancer, sida, etc. y que como y como y nunca engordo.. jaja..
muy bueno.

R.Galatea dijo...

Pensé también que era la única. Fantaseo, imagino, creo, resuelvo, soluciono, complico, etc. Eterna ciencia ficción!
Te leo desde hace un montón, hoy me anime a escribirte.
Excelente!
Saludos

Anónimo dijo...

Carolina llegue a tu blog por casualidad, y me encanta!! Felicitaciones... tu relato sobre los suenos de las mujeres es tal cual me pasa y yo pense que estaba loca de atar.. siempre sueno que me caso con Jon Bon Jovi y que somos de lo mas felices y es verdad una detalla toda la situacion a veces cuando estoy sonando y me quedo dormida retomo al otro dia en donde me quede para seguir la historia... jaja gracias a Dios encontre tu blog y ahora se que no estoy sola que somos millones las que estamos locas de atar!!!!!
Saludos Flavia

Anónimo dijo...

En honor a la verdad, chica, tienes mucho talento, has descrito a plenitud la mentalidad femenina. Aunque personalizas este escrito, creo que en cada trozo refleja a una mujer, a una mujer diferente y a la vez igual a todas. Y es que, al fin y al cabo, todas somos, no importa la apariencia, mujeres, y tendemos a hacer un mundo sensacional en nuestra cabeza/

Eugenia dijo...

A mi me encanta soñar despierta como a todo el mundo, solo que después voy y hago algunas de esas cosas!
Que manera de hacer el ridículo, madre mía!
Y tambien me divierte como loca, porque siempre pasan cosas mucho más locas de lo que uno imaginaba.

selma dijo...

Uy, yo soy una soñadora a toda hora. Mi fantasía actual es, mientras voy andando en bicicleta por la ciudad, encontrármelo a José Pablo Feinmann en el asiento trasero de un taxi. La ventanilla está baja y le digo que estoy enamorada de él. Lo que todavía no estoy muy segura es cómo comenzar la conversación... porque me parece cursi decirle que me gustan sus libros y sus artículos. Obviamente tengo que tener en cuenta la duración del semáforo, así que pienso minuciosamente cada palabra, tengo que ser concisa y directa. Bueno, la cuestión es que al final él termina invitándome a tomar un café. Y charlamos toda la tarde. Pero ojo, que no hay nada de sexo, es eso nomás.
Así que así voy por la calle, como una boluda mirando todos los taxis a ver si me lo encuentro. Un día de estos me voy a morfar un bondi y no cuento más el cuento.

selma dijo...

Uy, yo soy una soñadora a toda hora. Pero mis fantasías tienen que ver con situaciones que podrían llegar a ser reales. Por ejemplo mi fantasía actual es, mientras voy andando en bicicleta por la ciudad, encontrármelo a José Pablo Feinmann en el asiento trasero de un taxi. La ventanilla está baja y le digo que estoy enamorada de él. Lo que todavía no estoy muy segura es cómo comenzar la conversación... porque me parece cursi decirle que me gustan sus libros y sus artículos. Obviamente tengo que tener en cuenta la duración del semáforo, así que pienso minuciosamente cada palabra, tengo que ser concisa y directa. Bueno, la cuestión es que al final él termina invitándome a tomar un café. Y charlamos toda la mañana hasta el mediodía (porque esto ocurre a eso de las 9). Pero ojo, que no hay nada de sexo, es eso nomás.
Así que así voy por la calle, como una boluda mirando todos los taxis a ver si me lo encuentro. Un día de estos me voy a morfar un bondi y no cuento más el cuento.

selma dijo...

Uy, yo soy una soñadora a toda hora. Pero mis fantasías tienen que ver con situaciones que podrían llegar a ser reales. Por ejemplo mi fantasía actual es, mientras voy andando en bicicleta por la ciudad, encontrármelo a José Pablo Feinmann en el asiento trasero de un taxi. La ventanilla está baja y le digo que estoy enamorada de él. Lo que todavía no estoy muy segura es cómo comenzar la conversación... porque me parece cursi decirle que me gustan sus libros y sus artículos. Obviamente tengo que tener en cuenta la duración del semáforo, así que pienso minuciosamente cada palabra, tengo que ser concisa y directa. Bueno, la cuestión es que al final él termina invitándome a tomar un café. Y charlamos toda la mañana hasta el mediodía (porque esto ocurre a eso de las 9). Pero ojo, que no hay nada de sexo, es eso nomás.
Así que así voy por la calle, como una boluda mirando todos los taxis a ver si me lo encuentro. Un día de estos me voy a morfar un bondi y no cuento más el cuento.

Naty dijo...

No sé qué decir, salvo que me siento como si me hubiesen espiado la cabeza mientras estaba por dormirme, o mientras iba en el colectivo, o esperaba en un consultorio, o mataba algún minuto perdido.
Siempre pensé que la minucia era una cosa obsesiva mía. Por un lado es bueno sabe que es normal...

Selma dijo...

Me acordé de otra fantasía actual: están filmando una publicidad o una tira diaria de televisión en la calle. Un productor me ve pasar y les dice a todos "¡Es justo la persona que andábamos buscando!" ASí que me contratan y filmo toda la tarde. Pero termina ahí, no me hago famosa ni nada, porque no me interesa ni siquiera de fantasía. Así que, como ves, no soy muy pretenciosa con las fantasías. ¿Seré normal? Porque, por lo que veo, todos quieren ser famosos y exitosos. Yo no. No sé por qué será... es como que mis fantasías tienen que tener algo de realidad, sino, no me dan placer.

Muy bueno el blog asalgüeis.

selma dijo...

Me acordé de otra fantasía actual: están filmando una publicidad o una tira diaria de televisión en la calle. Un productor me ve pasar y les dice a todos "¡Es justo la persona que andábamos buscando!" ASí que me contratan y filmo toda la tarde. Pero termina ahí, no me hago famosa ni nada, porque no me interesa ni siquiera de fantasía. Así que, como ves, no soy muy pretenciosa con las fantasías. ¿Seré normal? Porque, por lo que veo, todos quieren ser famosos y exitosos. Yo no. No sé por qué será... es como que mis fantasías tienen que tener algo de realidad, sino, no me dan placer.

Muy bueno el blog asalgüeis.

Giuliana dijo...

que pasa con BODAS DE SANGREE!!

Anónimo dijo...

Con respecto a lo de ganarse un Oscar... Yo tuve uno parecido, pero en el mio yo era la acompanante del nuevo James Bond y entraba caminando por la alfombra roja con el, yo con 5 kilos menos y vistiendo un hermoso vestido de Armani. A proposito, la novia real de JB -de tan fea la probrecita- invitaba a pensar que -al fin y al cabo- los suenos pueden hacerse realidad. Y por que no? A seguir sonando...

Excelente el post!

Marcelo dijo...

Coincido...

Anónimo dijo...

Siempre imagino que me gano la lotería, planifico cuidadosamente qué hago con la plata, a quien le doy, cuánto, qué me compro, como es la casa cómo la decoro, donde viajo y con quien, en qué época del año, etc (he llegado al colmo de anotar cuanta plata y a quién le voy a dar!!!!).
Tengo también otras fantasías favoritas y las imagino mientras camino por la calle o voy en metro o la micro...me has hecho sentir más acompañada.

Isa

Ikiteño dijo...

de todo lo que dijiste, en los hombres tambien se aplica mucho de lo que dices, eso te lo puedo asegurar, saludos

Warrior dijo...

tal cual la parte que decís que pensamos todo antes de dormir! Yo también continúo las historias de una noche a otra. :P

Ignacia dijo...

Yo tambien pensaba que era una cualidad mia!! jajaja, pero veo que claramente no soy la unica: leer esto ha sido como leer el proceso exacto por el que paso... que empeora aun mas cuando estoy leyendo algun libro de aventuras fantasticas (me acabo de terminar Harry Potter 7 asi que mi mundo se ha transformado en toda una guerra de magos XD)

Saludos!

goloviarte dijo...

hola,te invito a participar en mi modesto blog directorio y de votaciones http://aquiestatublog.blogspot.com
acude y deja tu blog en el libro de visitas,darás a conocer tu blog
soy un particular en esta aventura,y voy de blog en blog escogiendo los mejores ,pero si consideras que dejarte esta información en comentarios es spam,te pido perdón y disculpas,y de paso mira en mi blog algo de publi,eso valora mi trabajo,gracias

Sr. MillionDollar dijo...

Me gustaría invitarte a mi blog
www.srmilliondollar.blogspot.com

www.lafotosaliomovida.com dijo...

Me encantó el post, me encantó mucho también el comentario de Francisco "Fantaseo como mujer", jajajaja, yo soy igual.

Culpa de la Calor dijo...

Qué bueno volver a leer.

Eso sí, para mí no tenías esa cara. Re loco.

Pelado Raso dijo...

Bueno no soy mucho de postear pero conforme pasan los años pierdo la esperanza de conseguir a la mujer ideal porque razono: las mejores estan ocupadas ya. Y asi... entro en un circulo vicioso de desesperanza y empiezo a visitar blogs como este. Ojala la realidad supere la ficcion de hollywood donde los corazones solitarios y endurecidos son iluminados tarde o temprano por la sorpresa de un amor en el lugar menos esperado. Un abrazo señoritas y creo que la puerta al amor verdadero esta ahi, siempre, al alcance de la mano, pero estamos muy enturbecidos para verla, solo necesitamos un poco de paz.

Anónimo dijo...

Lo tuyo es muy berreta bestiaria, trata de hacer algo más honesto.

Charlie dijo...

"...yo pienso que el vaso tiene vida, y que me quiere matar"

lo lei de un golpe y pense que era que el vaso tenia Sida

aporto al pesimismo: al diario ese le va a ir como el orto, lanata que se vaya a cagar

Saludos!

Cayetana Altovoltaje dijo...

¡¡Qué revelación!! ¿Así que no soy una loca? Fíjate que nunca se me ocurrió hablar de esto con mis amigas... :D
Totalmente identificada.

Anónimo dijo...

Alejandrosinfoto: hola!!!cuánto cobras?

Romina dijo...

Genial mujer!!! decir que pense que era la unica ya es por demas...la cosa es que la gente de mi alrrededor se rie muchisimos con las cosas que yo imagino..sueño despierta, pienso dormida a veces se torna una situacion complicada porque QUIERO QUE MI MENTE DESCANCE.
Pero confieso que seguramente mi abuela pensaria "a esta chica se lo volaron los pajaros de la cabeza" pero al igual que vos en todas la creaciones que tengo de mis historias, ya sea despierta o semi dormida...tamben prefiero creer que estoy haciendo justicia y que justa seria si fuese real.
Saludos
Lugar increible

Jamelgo dijo...

A que eres brillante. Aunque todos soñemos, también estoy convencido de que los sueños de las mujeres son muy diferentes de los nuestros. Quizás los hombres confundimos "delirio" con "sueño". La verdad decidí escribirte sólo por el título de la entrada, un gran poema ("...así llegué a saber / que toda la dicha humana /en fin, pasa como sueño"). Sigue así, te felicito.

la Dama sol dijo...

Mirá que bueno está tu blog y nunca habá pasado! quise opinar en la última entrada, pero no tenía para opinar...

Ahora que estoy saliendo con un hombre que realmente me gusta y no cambiaría por NADIE (porque es verdaderamente una preciosura salvaje y mimosa que además, lee mucho y tiene linda voz) y siendo mi primer amor -porque la verdad es que antes de él no había estado con nadie más de 3 o 4 veces y todo terminaba- fantaseo constantemente con refregárselo por la cara a muchachos que me gustan o gustaron con anterioridad y no me dieron bola. Porque como soy medio excéntrica, muchos no me dieron bola. En serio. Por suerte, mi P es tan excéntrico como yo, y además, es grandote, por lo que le ganaría peleando a cualquiera de esos insensibles que han sabido despreciar a mi enamoradizo corazón.
Eso, mujer ¿ahora tenés otro blog?
no entiendo bien eso de menear. No soy muy ducha en esto de los blogs. Yo tengo al mío, en el que escribo de vez en cuando, pero nada más. Vos tenés de todo, hasta estás llena de anuncios google ¿te pagan por ellos? me intriga.
Dios, cómo me gustaría que me paguen por escribir.
Un beso enorme, de La Gaviota.

Sol.

Anónimo dijo...

Feria de Sevilla

Feria de Abril

Carolina dijo...

Sol:

Sin ánimo de ofender:
http://buscon.rae.es/draeI/SrvltConsulta?TIPO_BUS=3&LEMA=rebalsar

Gabriel Lippmann dijo...

Es excelente este blog =)
--

El camino de un hombre con historias paralelas tratando,simplemente, de develar que es ese misterio que lo atormenta.


http://siguiendoelmisterio.blogspot.com/

Daniela dijo...

Una va creando su propia vida, a base de lo que anhela, y sus anhelos son sus sueños, de progresar, de vivir con intensidad, de arriesgar y evitar despertar.

Mariana Rossi dijo...

Es tan lindo soñarrr!!, en este momento mi mejor sueño es encontrar el amor y ser correspondida, hace mucho que lo espero.....
Tal vez cuando lo encuentre empiece a tener otras fantasías...jajaj..que morbosa, no?

Anónimo dijo...

Carolina ¡feliz dia!no queria dejar de saludarte hoy, ya que pones frente a todas nosotras un espejo donde mirarnos, que nos hace reflexionar, o simplemente reir un rato con tus brillantes descripciones.
espero ansiosa el proximo post
Mili

Anónimo dijo...

¡Hola! Yo mantengo un sitio web gratuito de citas. Amigosenlaciudad.com, que recibe muchos visitantes desde Cali. Mis miembros están siempre buscando cosas nuevas para divertirse, y apuesto que ellos estarían interesados en Bestiaria,y en tu articulo sobre La Vida es sueño. ¿Te gustaría intercambiar links con mi sitio? Sí te sientes curioso, esto es lo que tienes que hacer.

Primero, pon un link a Amigos en la página principal de tu sitio (Y si disfrutas de este sitio, por favor menciona eso cerca del link). Luego envíame el nombre de tu sitio, una descripción y/o un post de muestra, y un link para support@amigosenlaciudad.com o ram@themillermediagroup.com [Nota: Contenido para adultos, racista, y sitios de spam no serán aceptados] Después de que reciba su mail, ingresare a su sitio para verificar y testear el link hacia a Amigos. A continuación crearé un post sobre tu blog en el nuevo grupo Blog de Amigos, donde será visto por cientos de personas sumamente interesantes, así también como le enviare un email para hacerle saber que su sitio se encuentra publicado.
Gracias, Russell

Link a Amigos - Código Plano: http://amigosenlaciudad.comLink a

Amigos - Código con imagen de logo: http://amigosenlaciudad.com
Amigos Logo: http://img301.imageshack.us/img301/5159/amigosdiminutalogorr3.png

Anónimo dijo...

¡Hola! Yo mantengo un sitio web gratuito de citas. Amigosenlaciudad.com, que recibe muchos visitantes desde Cali. Mis miembros están siempre buscando cosas nuevas para divertirse, y apuesto que ellos estarían interesados en Bestiaria,y en tu articulo sobre La Vida es sueño. ¿Te gustaría intercambiar links con mi sitio? Sí te sientes curioso, esto es lo que tienes que hacer.

Primero, pon un link a Amigos en la página principal de tu sitio (Y si disfrutas de este sitio, por favor menciona eso cerca del link). Luego envíame el nombre de tu sitio, una descripción y/o un post de muestra, y un link para support@amigosenlaciudad.com o ram@themillermediagroup.com [Nota: Contenido para adultos, racista, y sitios de spam no serán aceptados] Después de que reciba su mail, ingresare a su sitio para verificar y testear el link hacia a Amigos. A continuación crearé un post sobre tu blog en el nuevo grupo Blog de Amigos, donde será visto por cientos de personas sumamente interesantes, así también como le enviare un email para hacerle saber que su sitio se encuentra publicado.
Gracias, Russell
Link a Amigos - Código Plano: http://amigosenlaciudad.comLink a

Amigos - Código con imagen delogo: http://amigosenlaciudad.com
Amigos Logo: http://
img301.imageshack.us/img301/5159/amigosdiminutalogorr3.png

FrancHis dijo...

Cuando estaba desempleada, solía subirme a los micros sin rumbo fijo sòlo para dedicarme al placer de fantasear sobre el presente, el pasado y el futuro. Si bien mi mente no para y no puedo dejar de hacerlo, viajar con música (no sòlo por el hecho de estar yendo de un sitio a otro) es un hobby adquirido.

Ahora ya tengo trabajo así que reservo ese placentero deporte para el dìa domingo.

Mar dijo...

Increible...y tranquilizador..ahora se que no soy la unica loca que se imagina escenas o conversaciones, pensando en qu quizas algun se materialicen tal cual..
o quizas no soy la unica "loca", eso es un consuelo!..
Me encanto

Fedra dijo...

Pensar pavadas... sobre todo cuando alguien que no conoces te obliga a escucharlo. Entonces pones gesto de "atento" y luego te dispones a las pavadas mas lujosas que puedas producir...

Te incluí en mis lecturas.

buenosairicon dijo...

hola bestiaria, me encanta me encanta!!!
genia total.
Te invito a hojear mi block (como dice alguna fan tuya por ahi que me hizo cagar de risa) Yo escribo para los argentinos que estan en el pais, los que estajn afuera y los que todavia no nacieron en buenosairicon.blogspot.com
besugos

buenosairicon dijo...

hola bestiaria, me encanta me encanta!!!
genia total.
Te invito a hojear mi block (como dice alguna fan tuya por ahi que me hizo cagar de risa) Yo escribo para los argentinos que estan en el pais, los que estan afuera y los que todavia no nacieron en buenosairicon.blogspot.com
besugos

Ivonne dijo...

Bestiaria ya no se actualiza?

Carolina dijo...

Chicos, como ya saben algunos, en julio va a salir el libro de este blog. Eso quiere decir que estoy reescribiendo el blog ENTERO. Son 70 artículos, entre ellos, algunos nuevos.

Sinceramente me hace mal ver el blog así, desactualizado. Parece un terreno con yuyos de dos metros, pero no me da el lomo para escribir todo el día Bestiaria y cuando termino, seguir con Bestiaria.

En cuanto termine el libro voy a volver a actualizar acá, obvio.

Aunque no parezca, los quiero y extraño que me digan villera, facha, morochita, boluda, diosa y todas esas delicias que me dejan en los comentarios.

Beso
Carolain

Emmanuel y Matias dijo...

hola soy emmanuel director de jadetel periodismo participativo me intereso sobre tu blog y los buenos ingresos que genera segun el diario perfil no se como lo lograste para recibir 1000 visitas pordia yo escribo de todo y no supera las 100 por dia pague un hosting y nada en fin podes linkearme y si queres podes participar escribiendo unas de tus noticias mas interesante saludos.

Anónima dijo...

Suerte con tu libro. desde acá lo estaremos esperando y suerte en la critica también

panzer dijo...

Carolina tienes un blog muy lindo, yo tengo uno de tecnologia y proximamente uno personal, me encantaria que tu blog tuviera algun enlace de contacto, por mas que lo busque no lo puede encontrar, y otra cosa pasate por forobloggers otra vez hacen falta buenos bloggers para seguir aprendiendo.

Jacobo dijo...

Hola, leo este blog pero nunca postee nada, queria pedirle ayuda, no se como cambiar el encabezamiento de mi blog, no entienco como cambiarla, te pasaria la imagen
si puedes explicarme o hacerlo(te pasaria la contraseña)
contacta aqui:
http://diariodeundeportivista.blogspot.es/
o en
jaco_the_boss@hotmail.com

Me gustaría que me contestes

Caro dijo...

Carolain,
además de felicitarte por escribir para otro blog, lo hago por el premio que te doy aqui:
http://carolinatour.blogspot.com/2008/03/recibo-mi-primer-premio-arte-y-pico.html

Cuando quieras, retiralo.
Y seguí tan capa.
Tus post me emocionan, me transportan, me dan ideas y sobre todo me hacen reir.
Hasta prontito,
Caro.

Anónimo dijo...

Síguiendo con aquello que la autora posteó en "Bodas...". Es cierto. La gente que usa lentes de contacto de color ( por puro gusto ) tiende a ser mediocre ( o "villera" como Bestiaria decía ), pero me queda la duda de si se refería solo a aquellos que usan lentes de contacto de color PORQUE SÍ y porque se les da la gana, y si siguen usándolos es porque asumen que les quedan bien o porque algún HDP les dijo que les quedan: "re-naturales" o también incluye a aquellos que tienen problemas de visión y les resulta incómodo usar todo el día anteojos, y encima están incapacitados para usar los lentes de contacto sin color, porque de tan transparentes que son, pasan desapercibidos ante la defectuosa visión de quién intenta ponérselos, por ende, los pierden y les viene como anillo al dedo adquirir lentes de contacto de color. Y si... la respuesta es si: soy miope y uso lentes de contacto de color, pero eso no me hace una villera!! "EEEHH LOKO!! SI TAN RE GÜENOS LOS LENTES DE COLOR!! NO SOY VISHERA X USARLO'! SOS FACHA VO´??? EH? EEEHH??".

Martín B dijo...

Podés encontrar pirulines en la entrada del Zoológico de Buenos Aires.

lanobil, dijo...

Mi sueño es que ella consiguiese todos esos sueños que mencionas, y algún día volviese desvalida, añorando lo imperfecto de mi amor.
Un saludo y espero que puedas visitarme.

Escarlata dijo...

Recién descubro tu blog, y ya soy una fanática!!! Me parece excelente todo, pero este artículo en especial, porque obviamente me siento totalmente identificada. Pero más que eso, al leer todos los comments, se puede decir que he encontrado la paz. ¿Por qué? Porque, a diferencia de vos que te creías única y que los sueños eran una parte importante de tu personalidad, yo creí siempre que, además de única... estaba bastante loca!! De verdad lo pensé y a veces llegué a preocuparme. También tropecé con varias de las piedras que describes en otro artículo, así que por fin voy a quedarme tranquila... no soy más que una mujer y con todo lo loca que conlleva pertenecer al género. Saludos...

Analía dijo...

Hola: queria dejar un comentario en el psot de arriba, pero no se puede. Por eso lo dejo aqui. me gustó tu sinceridad y como está escrito el post. No está mal quejarse...
Yo algo que odio y no soporto es la pacatería por ejmplo. Saludos

Un Angel en Bs As dijo...

te felicito por lo de tu nuevo blog
espero que leas este post xq no puedo escribir en el nuevo
yo quiero un trabajo asi :( jajaj
felicitacioenss

Ania dijo...

eii se k esto no viene alcaso pero estaba leyendo tu blog y keria pedir un favor. hay un concurso d QE en el k al meter un pins puedes ganar 50€ y votar os pediria por favor k si lo aseis votarais a NINIO_BLACK es mi amigo y canta genial de hexo ya mismo saltara a la fama porq busca un manager GRACIAS

Anónimo dijo...

eii se k esto no viene alcaso pero estaba leyendo tu blog y keria pedir un favor. hay un concurso d QE en el k al meter un pins puedes ganar 50€ y votar os pediria por favor k si lo aseis votarais a NINIO_BLACK es mi amigo y canta genial de hexo ya mismo saltara a la fama porq busca un manager GRACIAS

belleza palida dijo...

muy buenas entradas :D
Besos, seguí así.

Anónimo dijo...

recién he entrado a tu blog me he puesto a pensar que sería un maravilloso best seller y ahora q me entero q te publicán me he puesto feliz, es cómo si nos publicarán un poquito a todas .
Solo espero poder conseguir tu libro acá en México!
besitos
maggui

malén dijo...

soy tan ingenua que durante mucho tiempo pensé que era a la única que le pasaban estas cosas. ´tuve miedo de volverme completamente loca. y alguna vez también tuve miedo de agotar las posibilidades reales del destino y que nunca vuelva a pasarme una escena de novela en la vida real.
viva tu blog
amén

Euphoria dijo...

A mi me ayudó mucho leer "El cerebro femenino", me aclaró muchas cosas que justifican la lógica femenina en estudios concretos del cuerpo femenino y del alboroto que generan nuestras hormonas. Se los recomiendo (a uds. y a todos los hombres del planeta).

roooo dijo...

noo!!!
pensaba q solo yo hacia esas cosas... =(
en serio, a veces pienso q tngo demasiada imaginacion, m encanta armar supuestos sobre temas d peliculas, novelas, o q pasaria si por la calle pasara determinada cosa...yo...como actuaria?
es medio bajon darme cuenta q a varias personas les pasa lo mismo...
es como q le saca especialidad a lo q hago...pero bueno...
hay una pelicula q se llama el amor y otros desastres...m parece q sta muy relacionada con el tema porq uno d los protagonistas es escritor y demuestra totalment d lo q stamos hablando...se la pasa soñando e imaginando cosas, haciendo q la pelicula avance y retroceda por sus desvarios.
creo q la vida es asii, y por tanta imaginacion contarla tal cual seria una complicacion.

muy lindo est blog y el nuevo de la peleadora.
besos

romm|na dijo...

holaaa!! me ha encantado y gustado mucho tu blog!! feliciades, tienes muy buenas entradas, y creo que es muy interesante leerte! quisiera intercambiar enlaces con tu blog, los mios son Bailando por un sueño bailandoya y primicias de la farandula - soloprimicias espero que me aceptes en tu blogroll! exitos un saludo!!!

romina dijo...

holaaa!! me ha encantado y gustado mucho tu blog!! feliciades, tienes muy buenas entradas, y creo que es muy interesante leerte! quisiera intercambiar enlaces con tu blog, los mios son Bailando por un sueño bailandoya y primicias de la farandula - soloprimicias espero que me aceptes en tu blogroll! exitos un saludo!!!

Anónimo dijo...

genial artículo, he reído desde el alma con la sorpresa de saberme tan identificada con voz, genial mujer, y es cierto, por mi parte seguiré "haciendo justicia" con mis fantasías aunque por ahora estén monopolizadas en mi futuro esposo jojo, para que veas como lo tengo metido en el imaginario... y eso que ya voy por los 33, pero la estoy pasando bien y ya veré como se conecta a la realidad mi historia.... :-)

forex dijo...

Que miedo!!! yo soy igualita a todo lo que dices en tu historia, pareciera que soy yo de la que hablas. jaja

Chaulafanita dijo...

Ya todo esta dicho, pero para mi, sencillamente este es un blog extraordinario.
Felicitaciones desde Münster- Alemania. Saludos!

Anónimo dijo...

Gracias Dios! Después de tantos años pude ver que no soy la única que hace TODO eso que describís! Pensaba que me iba a volver loca!
Gracias! Mil gracias!

karen dijo...

gracias, simplemente gracias. Ahora que se que soy una mujer normal, o una loca más del montón, me voy a soñar que facundo arana me viene a buscar montado en falcor (el perro volador de la historia sin fin)y me lleva a caminar por la playa a la luz de la luna....

Cande dijo...

Que suene todo lo estúpido que quiera, pero GRACIAS por este post.
Me sentí más identificada y aliviada que con todas las postales de postsecret que vi hasta hoy.

Dr. Saturno dijo...

Totalmente de acuerdo con Manhattan Transfer, es asi y no hay vuelta.
Porfa visiten mi Blog:www.dr..saturno.blogspot.com
Me gustaria tener opiniones sobre mis articulos que son muy importtantes para mi
Muchas Graciass

Anónimo dijo...

yo ,he soñado ,en una caminata al aire libre , que pablo echarri ,se acercaba hacia mi .No me bastó con casi sentirlo en mi piel .Mi sueño tuvo que tener un sustento real ,necesito mezclarlo con mi vida actual y real Ordenadamente empiezo a darle una estructura a ese anhelo :1 ..porque el me viene a buscar 2: que tipo de crisis con mi marido tengo para darme permiso para una aventura semejante
3 :si no encuentro justificativos ,necesito matar a mi marido en un accidente en auto
4 Al fin y al cabo muchas veces no logro llegar a concretar de la bella fantasia.

Anónimo dijo...

yo ,he soñado ,en una caminata al aire libre , que pablo echarri ,se acercaba hacia mi .No me bastó con casi sentirlo en mi piel .Mi sueño tuvo que tener un sustento real ,necesito mezclarlo con mi vida actual y real Ordenadamente empiezo a darle una estructura a ese anhelo :1 ..porque el me viene a buscar 2: que tipo de crisis con mi marido tengo para darme permiso para una aventura semejante
3 :si no encuentro justificativos ,necesito matar a mi marido en un accidente en auto
4 Al fin y al cabo muchas veces no logro llegar a concretar de la bella fantasia.

Silvina dijo...

GRACIAAASSSSSS pense que estaba loca, y que despues de seis años tenia que llevar el tema a mi terapia, ahora no me siento mas sola.
Mis momentos en vez de ser de noche, son de dia, cuando viajo me escapo de la realidad y vivo en esa fantasia que tan bien describis... pensar que algunos opinan que soy callada , introvertida, no... simplemente estoy muy ocupada en mi cabeza planeando mis vidas alternativas que por supuesto nunca se concretan.

Analia dijo...

Carolina, realmente me encantó!!! Me alegra saber que no soy la única, ya que por verguenza no lo había comentado y sospeché, más de una vez, que estoy más loca de lo que creia! La proxima vez que alguien me encuentre riendome de lo que yo misma pienso, no voy a molestarme en dar ningún tipo de explicación y pasada la interrupción, continuaré en lo mio.
Gracias!

Milagritos dijo...

Gracias!!!!!! pense que era la unica loca que me invento una vida paralela, hay que alivio al parecer soy mas normal de lo que creia :D

carola josefa dijo...

jajajajajaja
este post me sacó carcajadas
besos

calamarita dijo...

yo pense q estaba locaa !! pero se ve q es mas norma de lo q creia .. jaja .. otro momento para delirar es cuando me baño tb, y los delirios hasta a veces son en capitulos, al dia suguiente continua, si vas conociendo gente (en la vida real) la voy incorporando al delirio de mi Pyme de pavadas q tengo en la cabeza (como dijo alguien mas arriba) .. la verdad es q es TAL CUAL ..

Anónimo dijo...

Gracias a Dios que escribiste esto, a mi me pas seguido tratar de evadirme de la realidad y soñar con ese hombre imposible, a veces pensaba que a mi edad 40 , esra patológico, pero me alegraste la vida, me hiciste dar cuenta lo que yo sabía, las vidas grises (tengo hijos, marido y trabajo interesante),necesitan fantasias locas para seguir viviendo.
Gracias Carolina.

Difusa dijo...

Siento un alivio absoluto al saber que este, mi secreto mejor guardado, el que nunca conte a nadie ni a mi terapeuta por miedo a que piense que estoy absolutamente loca, finalmente es mas común de lo que yo pensaba.
Desde chica tengo una imaginación desbordada y la canalizo en ese mundo imaginario paralelo...antes de dormir, mientras camino por la calle o estoy en el colectivo, pero cuando mas lo hago es mientras escucho musica.

Gracias por hacerme y hacernos sentir a todos un poquito mas "normales"

 
Licencia de Creative Commons
Bestiaria by Carolina Aguirre is licensed under a Creative Commons Atribución-NoComercial-SinDerivadas 3.0 Unported License.
Based on a work at bestiaria.blogspot.com.
Permissions beyond the scope of this license may be available at http://bestiaria.blogspot.com.